DNA barcoding
Phase 2 Update
In January 2007 the end of phase 2 workshop was held at the New York Botanical Garden. At this meeting scientists from Kew and its partner organizations were joined by representatives from the plant barcoding projects based at the Smithsonian Institution and the Canadian Centre for DNA Barcoding. The object of the workshop was to discuss the findings of the phase 2 research, and to reach a consensus on which of the regions investigated would be the most useful for DNA barcoding in land plants.
Proposed barcodes for plants
The discussions held at the New York workshop resulted in the proposal of two potential three-region barcodes for land plants:
Option 1: rpoC1, rpoB and matK
Option 2: rpoC1, matK, and trnH - psbA
Option 1 solely comprises coding plastid regions, whereas option 2 also includes a plastid intergenic spacer region, psbA - trnH, which was first proposed as a potential barcode for plants by Kress et al. 2005.
The major reason behind the decision to exclude the remaining three regions, accD, ndhJ, and YCF5, from the proposed barcodes was their absence from certain plant groups. Based on the information currently available, YCF5 is thought to have been deleted from the plastid genome of bryophytes, whereas accD is missing in the grass family and ndhJ is absent from Pinus and may be truncated or non-functional in some orchids.
The next step in the selection of the plant barcode will be to submit a proposal to the Consortium for the Barcode of Life (CBOL) containing the two options outlined above. A review process will then be undertaken to allow a decision to be reached on whether either of the two proposed options will be designated as the official DNA barcode for land plants. The reason for proposing two options was concerns over how well a highly length-variable region, such as psbA - trnH, would fit into the protocols that CBOL has developed for handling barcodes. None of the members of this project have sufficient skills/experience in such matters to perform such an evaluation.
Updated Protocols
Primers
In addition to the original sets of primers detailed in the phase 2 protocols the design of further primers was necessary to allow amplification of the target regions from certain taxonomic groups; in particular, the non-angiosperm groups required alternative primer pairs for several regions.
Gene |
Primer |
Direction |
Sequence 5'-3' |
matK |
X |
f |
TAATTTACGATCAATTCATTC |
F ( Equisetum ) |
f |
ATACCCCATTTTATTCATCC |
|
R ( Equisetum ) |
r |
GTACTTTTATGTTTACGAGC |
|
F ( Adiantum ) |
f |
GATGTTGCAGTCTATTCATTC |
|
rpoC 1 |
LP1 |
f |
TATGAAACCAGAATGGATGG |
LP5 |
r |
CAAGAAGCATATCTTGASTYGG |
|
rpoB |
LP1.1 |
f |
TCTAATATGCARCGTCAAGG |
LP3 |
r |
TTTACCCAAYRAAACATCHCC |
|
LP4.3 |
r |
ATAATACCTTTATTWCCATG |
|
LP5.2 |
r |
AAATAAGGCATATCTTGTCT |
|
accD |
LP1 |
f |
AGTATGGGYTCCGTHGTDG |
LP3 |
r |
ACCTGCRAATGCRATATATGC |
|
LP4 |
r |
ARATATTTCGCTYAAAACACC |
|
ndhJ |
LP1 |
f |
CATAGACCTTTRGGTTTYGA |
LP4 |
r |
ACCAATCCAASTATCRGGC |
Many of the primer combinations worked successfully for certain groups of plants; however, some primer pairs were found to work across a range of taxonomic groups and thus may represent the best starting point for testing the regions in additional plant groups. Listed below are those pairs of primers that were found to be optimal for each gene region.
| Gene |
Primer Pair |
Groups successfully used in |
| matK |
2.1a+5 |
Cattleya , Labordia , Sophronitis |
X+3.2 |
Inga |
|
X+5 |
Babiana, Conostylis, Dactylorhiza, Labordia |
|
F ( Equisetum )+R ( Equisetum ) |
Equisetum, Pinus, Picea, Encephalartos |
|
F ( Adiantum )+R ( Equisetum ) |
Asplenium, Dactylorhiza |
|
rpoC 1 |
1+3 |
Cattleya, Encephalartos, Labordia, Mimetes, Sophronitis, Triquetrella |
1+4 |
Babiana, Bryum, Cattleya, Conostylis, Dactylorhiza, Encephalartos, Labordia, Mimetes, Pinus, Sophronitis |
|
2+4 |
Anastrophyllum, Araucaria, Aytoniaceae, Babiana, Bryum, Cattleya, Conostylis, Cupressus, Dactylorhiza, Inga, Labordia, Pinus, Sophronitis |
|
LP1+LP5 |
Equisetum, Elaphoglossum |
|
rpoB |
1+3 |
Cattleya, Inga, Labordia, Sophronitis |
2+3 |
Cattleya, Conostylis, Dactylorhiza, Encephalartos, Labordia, Mimetes, Sophronitis |
|
2 + LP3 |
Araucaria, Pinus |
|
LP1.1+LP4.3 |
Equisetum |
|
LP1.1+LP5.2 |
Bryum, Encephalartos Pinus, Triquetrella |
|
accD |
1+3 |
Bryum, Cattleya, Labordia, Encephalartos, Mimetes, Sophronitis, Triquetrella |
1+4 |
Cattleya, Conostylis, Cupressus, Dactylorhiza, Encephalartos, Labordia, Mimetes, Pinus, Sophronitis |
|
1+LP3 |
Equisetum |
|
2+4 |
Araucaria, Aytoniaceae, Babiana, Cattleya, Conostylis, Dactylorhiza, Inga, Labordia, Pinus, Sophronitis |
|
LP1+LP4 |
Elaphoglossum |
|
ndhJ |
1+3 |
Araucaria, Aytoniaceae, Conostylis, Dactylorhiza, Inga |
1+4 |
Conostylis, Cupressus, Dactylorhiza, Labordia |
|
LP1+LP4 |
Anastrophyllum, Bryum, Equisetum, Triquetrella |
Amplification Conditions
Although the majority of samples amplified successfully using the standard conditions outlined in the phase 2 protocols, some modifications were required for certain combinations of regions and taxa.
matK
The segment of the matK gene that has been developed for use in barcoding is known to contain a region of secondary structure, which results in poor sequence quality. To overcome this problem, DMSO was routinely included in all PCR and sequencing reactions, adding 4% of the total reaction volume (0.8 of a microlitre in a 20 microlitre reaction).
The use of a reduced annealing temperature during PCR was also necessary to allow successful amplification of matK in a substantial proportion of samples. Temperatures used ranged between the standard of 53ºC and 46ºC.
LP primers
The LP, or 'Lower Plant', primers were designed to facilitate amplification in non-angiosperm groups. As a general rule, it was found that these primers worked with greater efficiency and reliability at an annealing temperature of 48ºC rather than at the standard 53ºC.
Other modifications
A touchdown PCR amplification profile was used for ndhJ with Aytoniaceae, Araucaria and Inga, and also for rpoB with Araucaria and Inga. A touch-up protocol was used to allow amplification of rpoB from Conostylis.
